DNA & RNA

Welche Bestandteile findet man im Chromatin?

Februar 1st, 2007 Autor: Phillip Kroll -

Das Chromatin besteht aus Fasern die zu etwa gleichen Teilen aus DNA und Proteinen bestehen. Zusätzlich findet man noch eine kleine Menge an RNA. Ist das Chromatin stark komprimiert spricht man von Heterochromatin, bei geringer Komprimierung von Euchromatin. Der Proteinanteil besteht aus Histon- und Nichthistonproteinen.

Den Komplex, der entsteht wenn DNA um die Histone gewunden wird, bezeichnet man als Nukleosom. Nichthiston-Proteine sorgen für eine weitere Verdichtung des Chromatins.

Welche Struktureigenschaften können DNA-Doppelhelices aufweisen?

Januar 28th, 2007 Autor: Phillip Kroll -

B-DNA

B-DNA ist die von Watson und Crick beschriebene DNA Struktur. Sie ist unter physiologischen Bedingungen die stabilste Struktur.

Eigenschaften

  • Rechtsgängig
  • Durchmesser ca. 2 nm
  • Basenpaare pro Windung: 10,5

A-DNA

A-DNA kommt in Lösungen mit relativ wenig Wasser vor. Es ist nicht abschließend geklärt ob A-DNA in vivo vorkommt.

Eigenschaften

  • Rechtsgängig
  • Durchmesser ca. 2,6 nm
  • Basenpaare pro Windung: 11

Z-DNA

Die Z-Form weicht in ihrer Struktur stärker von der B- und der A-Form ab. Sie ist dünner und länger. Die Bildung von Z-Helices benötigt eine alternierende Purin-Pyrimidin Sequenz. Sie bildet sich leichter in DNA Abschnitten mit einem hohen GC-Gehalt. Es ist nicht abschließend geklärt ob Z-DNA in vivo vorkommt.

Eigenschaften

  • Linksgängig
  • Durchmesser ca. 1,8 nm
  • Basenpaare pro Windung: 12
  • Zucker-Phospat Rückrat verläuft Zick-Zack (daher Z-DNA)

Sonderformen

  • Vier oder mehr aufeinander folgende Adenosinreste führen zu einer Biegung in der DNA. Sechs Adenosinreste führen zu einem Abknicken um 18°.
  • Palindromische DNA abschnitte sind zueinander komplementär und können so Haarnadelstrukturen (einsträngige DNA bzw. RNA) oder kreuzförmige Strukturen bilden (doppelstränige DNA bzw. RNA).
  • Tripel-Helix: Zusätzlich zu der Watson und Crick Basenpaarung kommen in einer Tripel-Helix auch Hoogsteen-Paarungen vor. Dies führt zu einer Dreifachhelix.
  • Tetraplex-DNA: In DNA-Sequenzen mit hohem Guanosin Anteil können sich vier DNA-Stränge zu einer Vierfachhelix paaren. Dieser Komplex wird dann auch als G-Tetrapex bezeichnet.
  • H-DNA: Spiegelbildlich angeordnete Wiederholungssequenzen können eine Dreifachhelix ausbilden.

Experiment zum Basengehalt von Proben

Januar 28th, 2007 Autor: Phillip Kroll - 2 Kommentare

Aufgabenstellung 1

In DNA Proben, die aus zwei unbekannten Bakterien isoliert wurden, bestehen die Basen insgesamt zu 32% (Bakterie 1) bzw. 17% (Bakterie 2) aus Adenin. Welche prozentualen Anteile an Adenin, Guanin, Thymin und Cytosin würden Sie aufgrund dessen in den beiden DNA-Proben erwarten?

Lösung

Die folgende Berechung setzt voraus, dass beide DNA-Proben doppelsträngig vorlagen.

Bakterie 1

32% Adenin => 32% Thymin => 64% AT-Gehalt => 36% GC-Gehalt => 18% Guanin und 18% Cytosin.

Bakterie 2

17% Adenin => 17% Thymin => 34% AT-Gehalt => 66% GC-Gehalt => 33% Guanin und 33% Cytosin.

Aufgabenstellung 2

Einer der beiden Bakterienspezies wurde aus einer heißen Quelle isoliert (64°C). Geben Sie an, welche DNA aus diesem thermophilen Bakterium stammt. Begründen Sie Ihre Antwort.

Lösung

Eine DNA mit hohem GC-Gehalt ist generell thermodynamisch stabiler. Das heißt es werden höhere Temperaturen benötigt um sie in Einzelstränge zu zerlegen. Dies beruht auf der höheren Stabilität der Guanin-Cytosin Paarung die aus drei Wasserstoffbrücken besteht (Adenin-Thymin Paarungen bestehen im Vergleich dazu nur aus zwei Wasserstoffbrückenbindungen). Demnach ist es wahrscheinlicher, dass die Bakterie 2 mit 17% Adenin (also einem GC-Gehalt von 66%) aus der heißen Quelle isoliert wurde.

Beispiel für Sequenzanalyse

Januar 28th, 2007 Autor: Phillip Kroll - 2 Kommentare

Aufgabe

Ein Strang einer doppelhelikalen DNA hat die Sequenz (5’) GCGCAATATTTCTCAAAATATTGCGC (3’). Geben Sie die Basenfolge des komplementären Strangs an. Welche spezielle Art von Sequenz ist in diesem DNA-Abschnitt? Kann diese doppelsträngige DNA irgendwelche alternativen Strukturen ausbilden?

Antwort

(5’) GCGCAATATTTCTCAAAATATTGCGC (3’)
(3’) CGCGTTATAAAGAGTTTTATAACGCG (5’)

Die Sequenzen enthalten ein Palindrom. Dies ermöglicht den einzelnen Strängen Haarnadelstrukturen auszubilden, bzw. dem Doppelstrang, eine Kreuzstruktur zu bilden.

Was geschieht wenn DNA erhitzt wird?

Januar 28th, 2007 Autor: Phillip Kroll -

DNA denaturiert bei erhöhter Temperatur oder bei extremen pH-Werten. Erhitzt man DNA lösen sich die anfangs noch zur Doppelhelix aufgewundenen DNA-Stränge voneinander. Sie sind lediglich über Wasserstoffbrücken verbunden und lassen sich deshalb voneinander trennen ohne dass sich das kovalent gebundene DNA-Rückrad aus Phosphat und Desoxiribose auftrennt. Da zwischen Guanin und Cytosin drei H-Brücken ausgebildet werden benötigt man um die Stränge zu trennen um so mehr Hitze desto höher der GC-Gehalt ist.

Der Effekt kann bei UV-Licht beobachtet werden, da ungepaarte Basen mehr UV-Licht absorbieren. Denaturiert man DNA steigt also die UV-Licht-Absorption. Diesen Vorgang bezeichnet man als hyperchromern Effekt.

Welche Erklärung ist plausibel dafür dass wir Thymin statt Uracil in der DNA haben?

Januar 28th, 2007 Autor: Phillip Kroll -

In der DNA paar sich Guanin mit Cytosin und Thymin mit Adenin. Würde man Thymin wie in der RNA durch Uracil ersetzen, müsste sich Adenin mit Uracil paaren. Cytosin kann aber durch eine einfache Desarminierung in Uracil umgewandelt werden. Tritt dies ein, kann es nicht mehr als Fehler erkannt werden, wenn Uracil standardmäßig in der DNA vorkäme. Stattdessen würde das entstandene Uracil mit Adenin gepaart werden. Dies würde dann zu einer ständigen Anreicherung von U-A Basen in der DNA führen.

Da alle Organismen sehr viel Energie in die Erhaltung und Reparatur der DNA stecken, scheint ihre Fehlerfreiheit wichtig für das Überleben eines Organismus zu sein. Dies erklärt den Selektionsdruck der wahrscheinlich die Verwendung von Thymin statt Uracil in der DNA verursacht hat.

Welche Einflüsse können die DNA schädigen?

Januar 28th, 2007 Autor: Phillip Kroll -

Schädigende Einflüsse

  • Strahlung. UV-Strahlung kann Zyklisierungen von Basen, besonders bei zwei hintereinander liegenden Tyminen, hervorrufen. Ionisierende Strahlung (Röntgen- und Gammastrahlung) können das kovalente Rückrat der DNA aufbrechen oder die Ringe der Basen zerstören.
  • Reaktive Chemikalien. Salpetrige Säure (Beschleunigt Desaminierung), Alkylierende Substanzen (Veränderung von bestimmten Basen)
  • Reaktive Sauerstoffverbindungen. Können Oxidationsschäden auslösen. Beispiele sind Wassertoffperoxid, Hydroxylradikale und Superoxidradikale. Sie entstehen durch Strahlung oder als Nebenprodukt des aeroben Stoffwechsels.

Mechanismen zur Reparatur von DNA

Januar 28th, 2007 Autor: Phillip Kroll -

(Methylorientierte) Fehlpaarungsreparatur

Der Mechanismus der Fehlpaarungsreparatur korrigiert falsch eingebaute Baasen unmittelbar nach der Replikation. Der neu synthetisierte Strang liegt kurz nach der Synthese noch unmethyliert vor und kann so von dem methylierten Matrizenstrang (an jeder GATC Sequenz metyliert) unterschieden werden. DNA in diesem Zustand wird als hemimethylierte DNA bezeichnet.

An der Fehlpaarungsstelle bildet sich ein Komplex aus MutL, MutH und MutS. Die DNA wird durch den Komplex in beide Richtungen gezogen, bis MutH eine GATC-Sequenz erkennt und den unmethylierten Strang abtrennt. Danach wird dieser DNA-Strang durch eine Reihe anderer Enzyme entfernt und neu synthetisiert.

Basen-Excisionsreparatur

DNA-Glycosylasen entfernen, unabhänig von der Methylierung, einzelne fehlerhafte Basen aus einem Doppelstrang. Sie spalten die Base an der 1'-glycosidischen Bindung ab und hinterlassen so eine Lücke, die so genannte abastische Stelle bzw. AP-Stelle. Weitere Enzyme entfernen das verbliebene Desoxyribose-5’-Phosphat und setzen ein neues Nukleotid ein.

DNA-Glycosylasen sind meist spezifisch für einen Typ von DNA-Beschädigung. So gibt es verschiedene Glycosylasen die verschiedene Desaminierungsprodukte von Basen erkennen oder darüber hinaus auch Pyrimidindimere.

Nucleotid-Excisionsreparatur

Exinucleasen ermöglichen eine Korrektur von schwerwiegenderen Fehlern in der Doppelhelixstruktur (z.B. Pyrimidindimere oder Basenderivate). Sie erkennen die beschädigte Stelle und schneiden ein Einzelstrang-Fragment von 12 bis 13 Nukletiden heraus. Die entstandene Lücke wird von DNA-Polymerase-I wieder geschlossen. DNA-Ligase schließt zuletzt noch den verbliebenen Nick.

Direkte Reparatur

Unter direkten Reparaturen fasst man Mechanismen zusammen die nicht eine defekte Base oder ein defektes Nukleotid austauschen, sondern sie wieder in den korrekten Originalzustand umwandeln.

Beispiele dafür sind DNA-Photolyasen, die Cyclobutan-Pyrimidindimere umwandelt, oder O6-Methylguanin-DNA-Methyltransferase, die den Methylrest des O6-Methylguanin auf sich überträgt und so wieder zu Guanin umwandelt.

Zusammenhang zwischen Basenpaaren im Gen und Aminonsäuren im Portein

Januar 28th, 2007 Autor: Phillip Kroll -

Aufgabe

Ein Enzym aus der Rattenleber besteht aus 192 Aminosäuren und wird von einem Gen mit 1440 Basenpaaren codiert. Erklären sie den Zusammenhang zwischen Zahl der Aminosäurereste im Enzym und der Zahl der Nucleotidpaare in der DNA.

Antwort

Das Enzym besteht aus 192 Aminosäuren. Da diese durch Basentripletts kodiert werden, werden dafür 3 x 192 = 576 Basenpaare benötigt. Da das Enzym in einem eukaryotischen Organismus hergestellt wird, stellen die 576 Basenpaare die Exons des Gens für das Enzym dar. Die restlichen 864 Basen sind also Introns die bei dem Splicing der prä-mRNA entfernt wurden. Dies zeigt wieso in eukaryotischen Zellen so viel mehr DNA ist als in prokaryotischen.

Welche Elemente sind auf einem Chromosom, neben den Genen noch zu finden?

Januar 28th, 2007 Autor: Phillip Kroll -

Eukaryotische Genome sind viel größer und komplexer als die von Prokaryoten. Neben den kodierenden Sequenzen, also den Genen gibt es weitere Sequenzelemente in der eukaryotischen DNA.

Centomer

Das Centomer ist eine Erkennungssequenz an die Proteine binden, die das Chromosom mit den Mitosespindeln verbindet. Es besteht aus kurzen DNA-Sequenzen die sich tausendfach wiederholen können.

Telomere

Telomere sind repetetive Sequenzen am Ende der Chromosomen. Sie wirken stabilisierend auf das Chromosom und können nicht ohne weiteres vom Transkriptionsapperat verdoppelt werden.

Satelliten DNA

Satelliten DNA ist einfache DNA die in sehr hoher Kopienzahl in der DNA vorkommt. Man unterscheidet hochrepetetive Sequenzen (Abschnitte aus wenigen Basenpaaren (<10) die sich mehrere Millionen Mal wiederholen können), und mittelrepetitive Sequenzen (Abschnitte aus wenigen hundert Basenpaaren die sich mehrere tausend Mal wiederholen können).

Exons/Introns

Introns sind nicht-kodierende RNA Abschnitte. Sie liegen zusammen mit Exon-Abschnitten auf der prä-mRNA. Der Prozess des Slicings entfernt die Introns aus der prä-mRNA und reift sie so zur mRNA.

LINE

LINE = Long interspersed nuclear element. LINES sind Transposons. Typischerweise 6-8kbp lang. Kann seinen Ort im Genom verändern und kodiert die dafür nötigen Enzyme. Sie kodieren jedoch keine weiteren Gene.

SINE

SINE = Short interspersed nuclear element. Typischerweise 100-400bp lang. Können mit Hilfe des Enzymapparates der Zelle ihre Position im Genom ändern. Sie kodieren jedoch keine weiteren Gene.

Transposon

Transposons sind DNA Abschnitte, die in der Lage sind ihren Genort zu verändern. Dies können sie erreichen indem sie die dafür notwendigen Gene selbst kodieren (autonom) oder den vorhandene Enzymapparat für die Transposition verwenden.

Superspiralisierung der DNA

Januar 28th, 2007 Autor: Phillip Kroll -

Bei einer DNA-Superhelix bildet die Achse der DNA-Doppelhelix wiederum eine Spirale und somit eine superhelikale Struktur.

Verwindungszahl L bzw. Lk

Lk beschreibt die Verwindung zweier topologisch gebundener DNA Stränge. Im relaxierten Zustand ist die Verwindungszahl gleich der Anzahl der Basenpaare dividiert durch die Anzahl der Basenpaare je Windung. Es gilt Lk = Tw + Wr.

Helikale Windung T bzw. Tw

Tw steht für die Windungszahl bzw. die lokale Spiralisierung. Tw ist eine geometrische Eigenschaft.

Superhelikale Windung W bzw. Wr

Wr ist ein Maß für den Grad der Superspiralisierung bzw. für die superhelikale Windung. Ist Wr = 0 liegt keine Superhelix vor. Ist Wr kleiner 0 liegt ein negativ superspiralisiertes DNA-Molekül vor und ist Wr größer 0 liegt ein positiv superspiralisiertes DNA-Molekül vor. Wr ist wie Tw eine geometrische Eigenschaft.

Aufgabe zur Verwindungszahl von DNA

Januar 28th, 2007 Autor: Phillip Kroll -

Ein geschlossenes ringförmiges DNA-Molekül hat in der relaxierten Form einen Lk-Wert von 500.

Wie viele Basenpaare enthält diese DNA ungefähr?

500 Verwindungen multipliziert mit der Anzahl an Basenpaaren pro Windung (10,4) ergibt die Anzahl der Basenpaare: 5200.

Wie verändert sich der Lk-Wert wenn ein Proteinkomplex gebunden ist und ein Nucleosom bildet?

Solange das kovalente Rückrad der DNA nicht aufgebrochen wird ändert sich auch die Verwindungszahl nicht. Lk bleibt gleich.

Wie verändert sich der Lk-Wert wenn ein DNA-Strang geschnitten wird?

Wenn ein DNA-Strang geschnitten wird, gibt es keine topographische Bindung mehr zwischen den beiden Strängen. Für einen solchen Fall ist Lk nicht definiert.

Wie verändert sich der Lk-Wert wenn ein DNA-Gyrase und ATP zur DNA-Lösung hinzugefügt werden?

Die Gyrase sorgt für negatives supercoiling also eine Endspiralisierung der DNA. Der Lk-Wert nimmt ab.

Wie verändert sich der Lk-Wert wenn die Doppelhelix durch Wärme denaturiert wird?

Wärme löst die Wasserstoffbrückenbindungen zwischen den Einzelsträngen dies ändert jedoch nichts an dem Lk-Wert (vorausgesetzt das kovalente Rückrad der beiden Stränge bleibt intakt).

Wie ist die Hierarchie des Chormatins, d.h. von der „nackten DNA“ als Doppelhelix bis zu den Chromatinfasern?

Januar 28th, 2007 Autor: Phillip Kroll -

Hierarchische Komprimierung des Chromatins

  • DNA-Helix wird um Histone gewunden (Nukleosom). DNA ist zwei mal um den Proteinkern des Nukleosoms gewunden.
  • Nukleosomen von Eukaryoten bestehen aus 8 Histonen, Oktamer (vier verschiedene Histontypen: H2A, H2B, H3, H4, jeweils zwei pro Nukleosom)
  • Wiederholungseinheit: 200 Bp. Davon sind ca. 146 mit Histonen in Wechselwirkung, der Rest dient als „Abstandshalter“ zum nächsten Nukleosom. Durchmesser eines Nukleosoms ist 10 nm. Verkürzung der DNA um Faktor 7.
  • DNA ist in linksgängiger Solenoid-Superspirale um den Oktamer gewickelt.
  • 30-nm-Faser entsteht wenn H1 an Nukleosomen bindet (Durchmesser 30 nm). In Nukleosomen verpackte DNA wird spiralisiert. Verkürzung der DNA um Faktor 40-50.
  • Weitere Aufwindung zu Chromatinschleifen, 250 nm, ca. 100.000 Bp pro Schleife.

Welche Eigenschaften zeichnen Histone aus?

Januar 28th, 2007 Autor: Phillip Kroll -
  • Fünf verschiedene Typen H2A, H2B, H3, H4 und H1. H2A, H2B, H3, H4 sind Kern-Histone, sie machen den Proteinkarn der Nukleosoms aus (je 2 = 8 pro Nukleosom).
  • Die Bindung von H1 an das Nukleosom führt zur Ausbildung der 30-nm-Faser.
  • Das aminoterminale Ende eines Histons kann von Enzymen modifiziert werden (Methylierung, Phosphorylierung, Ubiquitinylierung und Acetylierung)
  • Histonmodifikation beeinflusst die Zugänglichkeit der DNA unter anderem für die Transkription.
  • Histone sind globulär wobei die Enden der Aminosäurekette (Carboxy- und Aminoterminus) als „Arme“ nach außen ragen.
  • H3 und H4 neigen zur Bildung eines Dimeres, genauso wie H2A und H2B.
  • Histone sind stark konserviert d.h. die Aminosäuresequenz unterscheidet sich kaum von Art zu Art.
  • Histongene enthalten keine Introns und erhalten nach der Transkription keinen poly-A-Schwanz (also wie bei Prokaryoten)
  • Molekulargewicht zwischen 11.000 und 21.000
  • Reich an basischen Aminosäuren: Arginin und Lysin. (1/4 aller Aminosäurereste)

Welche Modifikationen können die Seitenketten der Flexiblen Arme der Histon erfahren?

Januar 28th, 2007 Autor: Phillip Kroll -

Acetylierung und Deacetylierung

HAT (Histon-Acetyltransferasen) acetyliert Lysin-Reste des Aminoterminus. Dies verringert die Affinität des Nukleosoms zur DNA und kann so als Signal zur Initiation der Transkription wirken. HDAC (Histon-Deacetylase) hat den gegenteiligen Effekt.

Phosporylierung

Setzt in den meisten Fällen wie die Acetylierung die Affinität des Nukelosomkerns zur DNA herab. Phospat wird auf Serin-Rest übertragen.

Weitere Modifikationen

Methylierung (irreversibel), Ubiquitinylierung.

Wie erfolgt die Replikation bei Prokaryoten?

Januar 28th, 2007 Autor: Phillip Kroll -
  • Die Replikation verläuft semikonservativ, d.h. alter Strang dient als Matrize zur Synthese des neuen.
  • Die Replikation beginnt immer am origin of replication (oriC) und läuft in beide Richtungen ab.
  • Der neue DNA-Strang wird immer in 5’=>3’ Richtung synthetisiert. Leserichtung ist in 3’=>5’ Richtung da sich die Stränge antiparallel paaren.
  • Synthese am Leitstrang (5’=>3’) erfolgt kontinuierlich (in die Richtung in die sich die Replikationsgabel bewegt), Synthese am Folgestrang (auch 5’=>3’) erfolgt diskontinuierlich (entgegengesetzt der Richtung in die sich die Replikationsgabel bewegt).
  • Bei diskontinuierlicher Synthese entstehen einzelne DNA-Fragmente (Okazaki-Fragmente). Sie werden von DNA-Ligase verknüpft.
  • Die Replikation wird von DNA-Polymerasen durchgeführt, sie benötigen immer einen Primer (kurzes RNA oder DNA Fragment, das zu einem Abschnitt des Matrizenstrangs komplementär ist) um mit der Replikation zu beginnen.

Was sind die grundlegenden Reaktionen und Eigenschaften von DNA-Polymerase?

Januar 28th, 2007 Autor: Phillip Kroll -
  • DNA Polymerasen verknüpfen Nukleotide miteinander. Dabei halten sie die Watson und Crick Basenpaarung ein (C-G, A-T).
  • Sie benötigen einen Matrizenstrang um einen neuen Strang zu synthetisieren.
  • DNA-Polymerasen benötigen einen Primer der an den Matrizenstrang gebunden ist um mit der Polymerisation zu beginnen.
  • Knüpft an die 3’-Hydroxylgruppe (Primerende) des Primers das neue Nukleotid an.
  • Bei der Polymerisierung wird eine Phosphodiesterbindungen zwischen 3'-Ende des einen und 5'-Ende des neuen Nukleotids gebildet. Dabei wird Pyrophosphat (PPi) abgespalten.
  • Verwendet Desoxynucleosid-5’-triphosphate (dATP, dGTP, dCTP, dTTP)
  • Die Anzahl an Nukleotiden, die eine DNA-Polymerasen aneinanderknüpft bevor sie sich wieder vom Matrizenstrang löst bezeichnet man als die Prozessivität. Sie ist von Enzym zu Enzym unterschiedlich.

Welche Funktion haben Topoisomerasen und welche Sorten gibt es?

Januar 27th, 2007 Autor: Phillip Kroll -

Topoisomerasen können generelle das Ausmaß der Aufwindung (Lk, siehe Verwindungszahl) von DNA steigern oder vermindern. Diese Funktion ist für die Superspiralisierung der DNA notwendig. DNA wird superspiralisiert um sie in eine kompaktere Form zu bringen. Bei E. coli sind bis jetzt vier verschiedene Topoisomerasen bekannt. Es werden zwei Typen von Topoisomerasen unterschieden.

Typ I

Topoisomerasen vom Typ I verändert die Verwindungszahl um ganzzahlige Vielfache von 1. Dies erreichen sie durch das Auftrennen eines DNA-Stranges (Phosphodiester Rückrad), den sie auf der anderen Seite des nicht aufgetrennten Stranges wieder zusammensetzen.

Typ II

Topoisomerasen vom Typ II verändern die Verwindungszahl um Vielfache von 2. Sie schneiden beide DNA-Stränge. Ein Beispiel für eine Topoisomerase des Typs II ist DNA-Gyrase, sie kann in Anwesenheit von ATP negative Superspiralisierung erzeugen und so Lk senken.

Der Aufbau der DNA

Januar 26th, 2007 Autor: Phillip Kroll -
  • Sequenz aus vier verschiedenen Desoxyribuonukleotiden: dAMP, dGMP, dCMP, dTMP.
  • Nukleoside sind durch Phospodiesterbrücken vom 3'-Ende der einen Desoxyribose zum 5'-Ende der nächsten Desoxyribose polymerisiert.
  • DNA liegt (fast) immer doppelsträngig vor, DNA-Stränge verlaufen antiparallel. Purinbasen paaren sich mit Pyrimidinbasen. Watson-Crick-Paarung: Adenin paart sich mit Thymin (2 H-Brücken) und Guanin mit Cytosin (3 H-Brücken).
  • Die Basen sind über n-gylkosidische Bindungen an das 1'-Ende der Desoxyribose gebunden.

Navigation


Suche


Linkblog